View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10120_low_16 (Length: 313)
Name: NF10120_low_16
Description: NF10120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10120_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 300
Target Start/End: Original strand, 43034663 - 43034962
Alignment:
| Q |
1 |
gaagagagtagcatcaggcatgcaagtcacgtgccgtacccccacttgtacaacaggtttacttacttttccttcaccactcacagttgaacccatcaca |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43034663 |
gaagagagcagcatcaggcatgcaagtcacgtgccgtacccccacttgtacaacaggtttacttacttttccttcaccactcacagttgaacccatcaca |
43034762 |
T |
 |
| Q |
101 |
aacccttcacccggtaaccactttgaacccaatattgcagaatcaatgcagaatttaccaccttttttcacactcactgtgccttcagcaattggttttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43034763 |
aacccttcacccggtaaccactttgaacccaatattgcagaatcaatgcagaatttaccaccttttttcacactcactgtgccttcagcaattggtattg |
43034862 |
T |
 |
| Q |
201 |
cattaacaggtccattgtcagagaaaagctctatcttgtagcccaagccatcgataggacctctctctcaccatgcctcgagacgaccccatgatgtcca |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |||| |
|
|
| T |
43034863 |
cattaacaggtccattgtcagagaaaagctctaccttgtagcccaagccatcgataggacctctctctcgccatgcctcgagatgaccccatgatttcca |
43034962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University