View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10120_low_17 (Length: 304)
Name: NF10120_low_17
Description: NF10120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10120_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 102 - 291
Target Start/End: Original strand, 9073068 - 9073257
Alignment:
| Q |
102 |
cttggtggttagggttgcagcaagtcttgcacttagagattctgtgaaacatgaagctactcgttgcatggagtcacctagtggtgttactactctattg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9073068 |
cttggtggttagggttgcagcaagtcttgcacttagagattctgtgaaacatgaagctactcgttgcatggagtcacctagtggtgttactactctattg |
9073167 |
T |
 |
| Q |
202 |
agctggtgtaggtaccttcttgctagcatgtattcaccttttgccactgcttcagcacatgctagaagcaagtgcactagttgatgtcca |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
9073168 |
agctggtgtaggtaccttcttgctagcatgtattcaccttttgccactgcttcagcacatgctagaagcaagtgcactaattgaagtcca |
9073257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 15 - 43
Target Start/End: Original strand, 9072981 - 9073009
Alignment:
| Q |
15 |
catagggtttgatgggaaggtagataaac |
43 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9072981 |
catagggtttgatgggaaggtagataaac |
9073009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University