View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10120_low_21 (Length: 254)
Name: NF10120_low_21
Description: NF10120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10120_low_21 |
 |  |
|
[»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 131 - 254
Target Start/End: Original strand, 4571618 - 4571741
Alignment:
Q |
131 |
tatctgcaaccacaattacggccacaacgttaaggttttgttatctatgtgacttcaattgtggttatatcaacaatacatcaattcacagtttgactgt |
230 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |||||| |
|
|
T |
4571618 |
tatctgcaaccacaattacggccacaacgtttaggttttgttatctatgtgacttcaattgtggttttatcaacaatacatttattcacagttagactgt |
4571717 |
T |
 |
Q |
231 |
aatatcaagaattacaacatgatc |
254 |
Q |
|
|
||||||||||||||| || ||||| |
|
|
T |
4571718 |
aatatcaagaattacgacgtgatc |
4571741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 4571505 - 4571542
Alignment:
Q |
18 |
actagcagcatttctgttttagttggatcatcataatg |
55 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
4571505 |
actagcagcatttctgttttagttggatcatcataatg |
4571542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University