View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10120_low_24 (Length: 250)
Name: NF10120_low_24
Description: NF10120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10120_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 18270169 - 18269935
Alignment:
| Q |
1 |
ctcctatgccgtctaaataaaggggatagggcttcagtcctattgttaaacaagataacaagggaaagctaaattaagacagactaaccttgctgcatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18270169 |
ctcctatgccgtctaaataaaggggatagggcttcagtcctattgttaaacaagataacaagggaaagctaaattaagacagactaaccttgctgcatag |
18270070 |
T |
 |
| Q |
101 |
ctctgttgcagttttcttattctccacttcctcaactacttttatcgcttctagccaccatgattcactgtagttgtcttcaacagtgtcttcatattgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
18270069 |
ctctgttgcagttttcttattctccacttcctcaactacttttatcgcttctagccaccatgaatcactgtagttgtcttcaacagtgtcttcatattgc |
18269970 |
T |
 |
| Q |
201 |
agaaaattgggcttgttatcattaggttgatgtcc |
235 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18269969 |
agaaaattgggcttgttatcattcggttgatgtcc |
18269935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University