View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10120_low_29 (Length: 233)
Name: NF10120_low_29
Description: NF10120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10120_low_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 217
Target Start/End: Complemental strand, 9073832 - 9073634
Alignment:
| Q |
19 |
gtggtaattcttcttctcaaatttctcaagagagtgatatgtatcatcaaatgggatctatggctagtgcttctctttcacaagctttacaacaagaaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9073832 |
gtggtaattcttcttctcaaatttctcaagagagtgatatttatcatcaaatgggatctatggctagtgcttctctttcacaagctttacaacaagaaag |
9073733 |
T |
|
| Q |
119 |
gtaccaagagaaacatcaaaagatgcaagctcaacaacagagtctaacagttcctattcaaattggaattgagcaggtaataaaatctttcctttgtct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9073732 |
gtaccaagagaaacatcaaaagatgcaagctcaacaacagagtctaacagttcctattcaaattggaattgagcaggtaataaaatctttcctttgtct |
9073634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University