View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10120_low_31 (Length: 220)
Name: NF10120_low_31
Description: NF10120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10120_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 17 - 204
Target Start/End: Original strand, 32024807 - 32024990
Alignment:
Q |
17 |
gaagacaaaccaaacatacacttagtttgttcgttgacctttgataatctttaataatgaggaaaatagatatgtgagtctcttttgggttgaactgtgt |
116 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32024807 |
gaagacaaaccaaacatacacttagtttgtt----gacctttgataatctttaataatgaggaaaatagatatgtgagtctcttttgggttgaactgtgt |
32024902 |
T |
 |
Q |
117 |
gattaaatggaattttgatgatctgtgtgtttgacttcttttgggttgttttctatttaatttgttgatttgggtttatgtttgatgt |
204 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32024903 |
gattaaatggaattttgatgatctgtgtgtttgacttcttttgggttgttttctatttaatttgttgatttgggtttatgtttgatgt |
32024990 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 86 - 171
Target Start/End: Original strand, 32026304 - 32026389
Alignment:
Q |
86 |
atatgtgagtctcttttgggttgaactgtgtgattaaatggaattttgatgatctgtgtgtttgacttcttttgggttgttttcta |
171 |
Q |
|
|
|||||||| |||||||||| || || ||| ||| |||||| |||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
T |
32026304 |
atatgtgaatctcttttggatttaagtgtatgagtaaatgaaattttgatgatctgtgtgtttgacttcattttggttgttttcta |
32026389 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University