View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10120_low_32 (Length: 209)
Name: NF10120_low_32
Description: NF10120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10120_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 18 - 195
Target Start/End: Original strand, 43015467 - 43015644
Alignment:
Q |
18 |
gttgttggtgtccctagtcctttaacaagcttcacaaatgctttggatattcaacaccttaaatctgatcattttggcttcatcccatttcgaaaaagct |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43015467 |
gttgttggtgtccctagtcctttaacaagcttcacaaatgctttggatattcaacaccttaaatctgatcattttggcttcatcccatttcgaaaaagct |
43015566 |
T |
 |
Q |
118 |
atgatgaagtaagttacatatattatacagtaagacacttatgattgaagatatgtctagtgtttgacacatgttcat |
195 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
43015567 |
atgatgaagtaagttacatatattatacagtaagacacttctgattgaagatatgtctagtgtttgacacatgttcat |
43015644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University