View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10121_high_17 (Length: 251)
Name: NF10121_high_17
Description: NF10121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10121_high_17 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 11 - 251
Target Start/End: Complemental strand, 12157901 - 12157661
Alignment:
| Q |
11 |
cataggctccttgcctttcatttactttggagttccaattttcaaaggtagaccaaaannnnnnnattgtctaacctattgctaacaaaatcaagctgaa |
110 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12157901 |
cataggctccctgcctttcatttactttggagttccaattttcaaaggtagaccaaaatttgtttattgtctaacctattgctaacaaaaccaagctgaa |
12157802 |
T |
 |
| Q |
111 |
attatctacttggaaatcatctttgctgatttatggcccttctgtcaattctttgcttgtttttactttaaaagacattaagagatgtaaacttgagaga |
210 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12157801 |
attatctgcttggaaatcatctttgctgatttatggcccttctgtcaattctttgcttgtttttactttaaaagacattaagagatataaacttgagaga |
12157702 |
T |
 |
| Q |
211 |
ttgtttatgaagttgctgctttagaagctagcatgctagtc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12157701 |
ttgtttatgaagttgctgctttagaagctagcatgctagtc |
12157661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University