View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10121_high_22 (Length: 242)
Name: NF10121_high_22
Description: NF10121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10121_high_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 48 - 135
Target Start/End: Complemental strand, 31132715 - 31132628
Alignment:
| Q |
48 |
tatctcctacttggtatttaaataaaaaatacttaatggcacgacatgatatgtcgtgcaatccacacatgtattccacaaagagaaa |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
31132715 |
tatctcctacttggtatttaaataaaaaatgcttaatggcacgacatgatatgtcttgcaatccacacatgtattccataaagagaaa |
31132628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 161 - 234
Target Start/End: Complemental strand, 31132602 - 31132526
Alignment:
| Q |
161 |
attaaaggcacgtgagtgttgtgcggttttgttggtgcaatatgtc--gttca-agtggcattgctcaaatttcaaa |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| ||||| ||||| |||||||||||||||| |
|
|
| T |
31132602 |
attaaaggcacgtgagtgttgtgcggttttgttggtgcaatacgtcgtgttcacggtggcgttgctcaaatttcaaa |
31132526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University