View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10121_low_102 (Length: 223)
Name: NF10121_low_102
Description: NF10121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10121_low_102 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 15 - 200
Target Start/End: Original strand, 45668069 - 45668255
Alignment:
| Q |
15 |
agcacagaagaatctaccgcagatttgtactaatcaccttgatcctacatcggtaatcataatcattgataattgatttcaattttgtcaactagtta-g |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45668069 |
agcacagaagaatctaccgcagatttgtactaatcaccttgatcctacatcggtaatcataatcattgataattgatttcaattttgtcaactagttagg |
45668168 |
T |
|
| Q |
114 |
gagtcttagtttcattcgaaagaacagaaaatagatatctctgctaatgcttgcttataacttgaactttcagtgactggttttatt |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45668169 |
gagtcttagtttcattcaaaagaacagaaaatagatctctctgctaatgcttgcttataacttgaactttcagtgactggttttatt |
45668255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University