View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10121_low_105 (Length: 219)
Name: NF10121_low_105
Description: NF10121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10121_low_105 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 34431847 - 34431640
Alignment:
| Q |
1 |
aaaaagtgtttttctagaagtgtgcttttaaagtgaatgtgacaatgagaaaagaaactctcttttttagttgttttcttttaaccaattaattaaggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34431847 |
aaaaagtgtttttctagaagtgtgcttttaaagtgaatgtgacaatgagaaaagaaactctcttttttagttgttttcttttaaccaattaattaaggtt |
34431748 |
T |
|
| Q |
101 |
gcgatgttttactattgttcgacgatgctaggataatctttttcattctcgaaaagg----nnnnnnnntatggtaatctaaagtttggtcggatattaa |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34431747 |
gcgatgttttactattgttcgacgatgctaggataatctttttcattctcgaaaaggaaaaaaaaaaaatatggtaatctaaagtttggtcggatattaa |
34431648 |
T |
|
| Q |
197 |
caacaatt |
204 |
Q |
| |
|
|||||||| |
|
|
| T |
34431647 |
caacaatt |
34431640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University