View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10121_low_110 (Length: 201)
Name: NF10121_low_110
Description: NF10121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10121_low_110 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 15 - 173
Target Start/End: Original strand, 8444066 - 8444226
Alignment:
| Q |
15 |
atgaaggtacttgtgtgtgtatttttgaataaaggtaaaa-aatatttatttattatgtctaagtctttgattttctatgctcatcataatctttttact |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8444066 |
atgaaggtacttgtgtgtgtatttttgaataaaggtaaaaaaatatttatttattatgtctaagtctttgattttctatgctcatcataatctttttact |
8444165 |
T |
 |
| Q |
114 |
tttataattactctctctatttcatatatttcatcaa-tttgtaattttcttgatagctat |
173 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8444166 |
tttataattactctctctagttcatatatttcatcaattttgtaattttcttgatagctat |
8444226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 54 - 138
Target Start/End: Original strand, 23239252 - 23239336
Alignment:
| Q |
54 |
aaatatttatttattatgtctaagtctttgattttctatgctcatcataatctttttacttttataattactctctctatttcat |
138 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||| | || |||| || ||||| || |||||||| ||||||| ||||||| |
|
|
| T |
23239252 |
aaatatttatctattatgtctaagcctttgattttcttttatcgtcatcatttttttgctcttataatttctctctcaatttcat |
23239336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University