View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10121_low_19 (Length: 479)
Name: NF10121_low_19
Description: NF10121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10121_low_19 |
 |  |
|
[»] scaffold1024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 366; Significance: 0; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 1 - 469
Target Start/End: Complemental strand, 1787352 - 1786880
Alignment:
Q |
1 |
tattttctttgtatctatacaaactagatttactacgctcaacaaaagtacgcagtcacgcattcaggataatcttgatt---cgatcaagatgaccatt |
97 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
1787352 |
tattttctttgtatctatacaaactagatttattacggtcaacaaaagtacgcagtcacgcattcaggataatcttgattgttcgatcaagatgaccatt |
1787253 |
T |
 |
Q |
98 |
caattaagattagacgatttccgatatcagactatgtgaatgtgggttc-tcctaattgcaggaaccctagtcttgtgtggtcacaaacatttagataca |
196 |
Q |
|
|
|||| ||||| |||||||| || ||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
1787252 |
caatcaagatcagacgattcccaatatcagactacgtgaatgtgggttcctcctaattgcaggaaccctagtcttgtatggtcacaaacatttagataca |
1787153 |
T |
 |
Q |
197 |
ccatttagtcacatatacaagtcttatgtggtcacaaacattttgatacatacaccatttaatcacaaatacatatttgaaaaagttataaaaaataaaa |
296 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1787152 |
tcatttagtcacatatacaagtcttatgtggtcacaaacattttgatacatacaccatttaatcacaaatacatatttgaaaaagttataaaaaataaaa |
1787053 |
T |
 |
Q |
297 |
gaattgaataaagtacannnnnnnaggaaagaaaaatatagttacacctaagtattttccgaatatattatctttacatttttaattcaaactaactcgg |
396 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| || |
|
|
T |
1787052 |
gaattgaataaagtacatttttttaggaaagaaaaatatagttatacctaagtattttccgaatatattgtctttacatttttaattcaaactaacttgg |
1786953 |
T |
 |
Q |
397 |
gcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccaccctttttgtaacc |
469 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||||||| |
|
|
T |
1786952 |
acgagagtagtattaggatgggtgaccttctggtaagtctttgtgttgcacctctcccaccctttgtgtaacc |
1786880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 395 - 457
Target Start/End: Original strand, 18860052 - 18860114
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacc |
457 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
T |
18860052 |
gggcgagagtagtactaggatgggtgacctcctggaaagtccttgtgttgcacctctcccacc |
18860114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 16477142 - 16477086
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
16477142 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
16477086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 1e-23; HSPs: 42)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 395 - 463
Target Start/End: Complemental strand, 12178976 - 12178908
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
463 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
T |
12178976 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctctcccaccattttt |
12178908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 395 - 463
Target Start/End: Complemental strand, 12184360 - 12184292
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
463 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
T |
12184360 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctctcccaccattttt |
12184292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 395 - 463
Target Start/End: Complemental strand, 12189695 - 12189627
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
463 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
T |
12189695 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctctcccaccattttt |
12189627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 395 - 463
Target Start/End: Complemental strand, 12172506 - 12172438
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
463 |
Q |
|
|
|||||||||||||| ||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
T |
12172506 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtattgcacctctcccaccgttttt |
12172438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 395 - 463
Target Start/End: Complemental strand, 12182456 - 12182388
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
463 |
Q |
|
|
|||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
T |
12182456 |
gggcgagagtaggactaggatgggtgacctcctgggaagtccttgtgttgcacctctcccaccattttt |
12182388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 395 - 463
Target Start/End: Complemental strand, 12189351 - 12189283
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
463 |
Q |
|
|
|||||||||||||| |||||||| |||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
T |
12189351 |
gggcgagagtagtactaggatggatgacctcctgggaagtccttgtgttgcacctctcccaccattttt |
12189283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 397 - 463
Target Start/End: Complemental strand, 12169217 - 12169151
Alignment:
Q |
397 |
gcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
463 |
Q |
|
|
|||||||||||| ||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
T |
12169217 |
gcgagagtagtactaggatgggtgacctcctgggaagtccttgtattgcacctctcccacctttttt |
12169151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 395 - 461
Target Start/End: Complemental strand, 12180539 - 12180473
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
461 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
T |
12180539 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgtttaacctctcccacccttt |
12180473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 395 - 461
Target Start/End: Complemental strand, 12180877 - 12180811
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
461 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||| |||||||||||||||||||||||||| |||| |
|
|
T |
12180877 |
gggcgagagtagtactaggatgggtgacctcctggaaagtccttgtgttgcacctctcccacgcttt |
12180811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 395 - 461
Target Start/End: Complemental strand, 12182113 - 12182047
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
461 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
T |
12182113 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgtttaacctctcccacccttt |
12182047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 455
Target Start/End: Complemental strand, 12169534 - 12169474
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctccca |
455 |
Q |
|
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
12169534 |
gggcgagagtagttctaggatgggtgaccttttgggaagtccttgtgttgcacctctccca |
12169474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 463
Target Start/End: Complemental strand, 12177396 - 12177328
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
463 |
Q |
|
|
|||||||||||||| |||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
T |
12177396 |
gggcgagagtagtactaggatgggtgaccacctgggaagtccttgtattgcacctctcccaccattttt |
12177328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 395 - 461
Target Start/End: Complemental strand, 12170123 - 12170057
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
461 |
Q |
|
|
|||||||||||||| || |||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
T |
12170123 |
gggcgagagtagtactatgatgggtgacctcttgggaagtccttgtgttgcacctctcccatccttt |
12170057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 395 - 463
Target Start/End: Complemental strand, 12173172 - 12173104
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
463 |
Q |
|
|
|||||||||||||| ||||||||||||||| || |||||||||||| |||||| ||||||||| ||||| |
|
|
T |
12173172 |
gggcgagagtagtactaggatgggtgacctcctaggaagtccttgtattgcacatctcccaccattttt |
12173104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 395 - 463
Target Start/End: Complemental strand, 12185022 - 12184954
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
463 |
Q |
|
|
|||||||||||||| ||||||||||| ||| |||||| |||||| |||||||||||||||||| ||||| |
|
|
T |
12185022 |
gggcgagagtagtactaggatgggtggcctcctgggaggtccttttgttgcacctctcccaccattttt |
12184954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 395 - 463
Target Start/End: Complemental strand, 12185366 - 12185298
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
463 |
Q |
|
|
|||||||||||||| |||||||||| ||| || ||||||||||||||||||||||||||||| ||||| |
|
|
T |
12185366 |
gggcgagagtagtacaaggatgggtgtcctcctaggaagtccttgtgttgcacctctcccaccattttt |
12185298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 395 - 463
Target Start/End: Complemental strand, 12186671 - 12186603
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
463 |
Q |
|
|
|||||||||||||| |||||||||| ||| ||| |||||||||||||||||||||||||||| ||||| |
|
|
T |
12186671 |
gggcgagagtagtacgaggatgggtgtcctcctgagaagtccttgtgttgcacctctcccaccattttt |
12186603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 395 - 463
Target Start/End: Complemental strand, 12187014 - 12186946
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
463 |
Q |
|
|
|||||||||||||| ||||||||||| ||| |||||| |||||| |||||||||||||||||| ||||| |
|
|
T |
12187014 |
gggcgagagtagtactaggatgggtggcctcctgggaggtccttttgttgcacctctcccaccattttt |
12186946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 395 - 463
Target Start/End: Complemental strand, 12187358 - 12187290
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
463 |
Q |
|
|
|||||||||||||| |||||||||| ||| || ||||||||||||||||||||||||||||| ||||| |
|
|
T |
12187358 |
gggcgagagtagtacaaggatgggtgtcctcctaggaagtccttgtgttgcacctctcccaccattttt |
12187290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 395 - 463
Target Start/End: Complemental strand, 12188665 - 12188597
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
463 |
Q |
|
|
|||||||||||||| |||||||||| ||| ||| |||||||||||||||||||||||||||| ||||| |
|
|
T |
12188665 |
gggcgagagtagtacgaggatgggtgtcctcctgagaagtccttgtgttgcacctctcccaccattttt |
12188597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 398 - 461
Target Start/End: Complemental strand, 12184013 - 12183950
Alignment:
Q |
398 |
cgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
461 |
Q |
|
|
||||||||||| ||||||||||||||| || ||||||||||||||| |||||||||||||||| |
|
|
T |
12184013 |
cgagagtagtactaggatgggtgacctccttggaagtccttgtgtttaacctctcccacccttt |
12183950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 395 - 454
Target Start/End: Complemental strand, 12189008 - 12188949
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctccc |
454 |
Q |
|
|
||||||||||||| ||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
T |
12189008 |
gggcgagagtagttctaggatgggtgacctcctgggaagttcttgtgttgcacctctccc |
12188949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 395 - 461
Target Start/End: Complemental strand, 12172831 - 12172765
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
461 |
Q |
|
|
|||||||||||||| |||||||| |||||| ||||| ||||||||| ||| |||||||||||||||| |
|
|
T |
12172831 |
gggcgagagtagtactaggatggatgacctcctgggtagtccttgtattgaacctctcccacccttt |
12172765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 395 - 461
Target Start/End: Complemental strand, 12174181 - 12174115
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
461 |
Q |
|
|
|||||||||||||| |||||||| |||||| |||| ||||||||||||| |||||||||||||||| |
|
|
T |
12174181 |
gggcgagagtagtactaggatggatgacctcctggaaagtccttgtgtttaacctctcccacccttt |
12174115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 395 - 461
Target Start/End: Complemental strand, 12174847 - 12174781
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
461 |
Q |
|
|
|||||||||||||| |||||||| ||| || ||||| ||||||||||||| |||||||||||||||| |
|
|
T |
12174847 |
gggcgagagtagtactaggatggatgatctcctgggtagtccttgtgttgaacctctcccacccttt |
12174781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 395 - 461
Target Start/End: Complemental strand, 12178633 - 12178567
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
461 |
Q |
|
|
|||||||||||||| || |||||||| ||| |||||||||||||||||| |||||||||||||||| |
|
|
T |
12178633 |
gggcgagagtagtactatgatgggtgtcctcctgggaagtccttgtgtttaacctctcccacccttt |
12178567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 395 - 461
Target Start/End: Complemental strand, 12184680 - 12184614
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
461 |
Q |
|
|
|||||||||||||| |||||||||||||| |||| |||||||||||||||||||||| ||| |||| |
|
|
T |
12184680 |
gggcgagagtagtaccaggatgggtgacctcctggaaagtccttgtgttgcacctctctcacgcttt |
12184614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 395 - 463
Target Start/End: Complemental strand, 12174522 - 12174454
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
463 |
Q |
|
|
|||||||||||||| ||||||||||||| | || |||||||||||| |||||| ||||||||| ||||| |
|
|
T |
12174522 |
gggcgagagtagtactaggatgggtgacgtcctaggaagtccttgtattgcacatctcccaccattttt |
12174454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 395 - 461
Target Start/End: Complemental strand, 12173499 - 12173433
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
461 |
Q |
|
|
|||||||||||||| |||||||| ||| || ||||| |||||||||| || |||||||||||||||| |
|
|
T |
12173499 |
gggcgagagtagtactaggatggatgatctcctgggtagtccttgtgctgaacctctcccacccttt |
12173433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 395 - 461
Target Start/End: Complemental strand, 12173840 - 12173774
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
461 |
Q |
|
|
||||| |||||||| |||||||| |||||| |||| ||||||||||||| |||||||||||||||| |
|
|
T |
12173840 |
gggcgggagtagtactaggatggatgacctcctggaaagtccttgtgtttaacctctcccacccttt |
12173774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 395 - 461
Target Start/End: Complemental strand, 12179300 - 12179234
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
461 |
Q |
|
|
|||||||||||||| | ||||| |||||| ||||||||||||||||||| ||||||||||| |||| |
|
|
T |
12179300 |
gggcgagagtagtactttgatggatgacctcctgggaagtccttgtgttgaacctctcccacgcttt |
12179234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 395 - 453
Target Start/End: Complemental strand, 12182780 - 12182722
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcc |
453 |
Q |
|
|
|||||||||||||| | |||||| |||||| ||||||||||||||||||| |||||||| |
|
|
T |
12182780 |
gggcgagagtagtacttggatggatgacctcctgggaagtccttgtgttgaacctctcc |
12182722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 395 - 445
Target Start/End: Complemental strand, 12170711 - 12170661
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgc |
445 |
Q |
|
|
|||||||||||||| || |||||||||||| |||||||||| ||||||||| |
|
|
T |
12170711 |
gggcgagagtagtactatgatgggtgacctcctgggaagtcattgtgttgc |
12170661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 395 - 461
Target Start/End: Complemental strand, 12175189 - 12175124
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
461 |
Q |
|
|
||||| |||||||| |||||||| |||| | |||||||||||||||||| |||||||||||||||| |
|
|
T |
12175189 |
gggcgggagtagtactaggatggatgac-tcctgggaagtccttgtgtttaacctctcccacccttt |
12175124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 398 - 463
Target Start/End: Complemental strand, 12177052 - 12176985
Alignment:
Q |
398 |
cgagagtagtattaggatgggtgaccttct---gggaagtccttgtgttgcacctctcccacccttttt |
463 |
Q |
|
|
||||||||||| ||||||||||||||| || ||||||||||| |||||||||||||||||| ||||| |
|
|
T |
12177052 |
cgagagtagtactaggatgggtgacct-ctagggggaagtccttttgttgcacctctcccaccattttt |
12176985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 395 - 444
Target Start/End: Complemental strand, 12169828 - 12169779
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttg |
444 |
Q |
|
|
|||||||||||||| || |||||||||||| |||||||||| |||||||| |
|
|
T |
12169828 |
gggcgagagtagtactatgatgggtgacctcctgggaagtcattgtgttg |
12169779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 395 - 445
Target Start/End: Complemental strand, 12170417 - 12170367
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgc |
445 |
Q |
|
|
|||||||||||||| || |||||||||||| || ||||||| ||||||||| |
|
|
T |
12170417 |
gggcgagagtagtactatgatgggtgacctcctaggaagtcattgtgttgc |
12170367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 397 - 450
Target Start/End: Complemental strand, 4375032 - 4374979
Alignment:
Q |
397 |
gcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctc |
450 |
Q |
|
|
|||||||||||| ||||||| ||||| | || |||| ||||||||||||||||| |
|
|
T |
4375032 |
gcgagagtagtaataggatgtgtgacttcctaggaaatccttgtgttgcacctc |
4374979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 426 - 463
Target Start/End: Complemental strand, 12185678 - 12185641
Alignment:
Q |
426 |
ctgggaagtccttgtgttgcacctctcccacccttttt |
463 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||||| |
|
|
T |
12185678 |
ctgggaagtccttgtgtcgcacctctcccaccattttt |
12185641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 426 - 463
Target Start/End: Complemental strand, 12187670 - 12187633
Alignment:
Q |
426 |
ctgggaagtccttgtgttgcacctctcccacccttttt |
463 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||||| |
|
|
T |
12187670 |
ctgggaagtccttgtgtcgcacctctcccaccattttt |
12187633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 426 - 459
Target Start/End: Original strand, 17817947 - 17817980
Alignment:
Q |
426 |
ctgggaagtccttgtgttgcacctctcccaccct |
459 |
Q |
|
|
|||||||||||||||||||||||| ||||||||| |
|
|
T |
17817947 |
ctgggaagtccttgtgttgcacctatcccaccct |
17817980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 430 - 463
Target Start/End: Complemental strand, 19156159 - 19156126
Alignment:
Q |
430 |
gaagtccttgtgttgcacctctcccacccttttt |
463 |
Q |
|
|
|||||||||||||||||||||||||||| ||||| |
|
|
T |
19156159 |
gaagtccttgtgttgcacctctcccaccattttt |
19156126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 8e-19; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Original strand, 21825768 - 21825824
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
21825768 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
21825824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 398 - 452
Target Start/End: Complemental strand, 25904784 - 25904730
Alignment:
Q |
398 |
cgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctc |
452 |
Q |
|
|
|||||||||||||| ||||| ||||||| ||| |||||||||||||||||||||| |
|
|
T |
25904784 |
cgagagtagtattaagatggatgaccttttggaaagtccttgtgttgcacctctc |
25904730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 8e-19; HSPs: 50)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24621749 - 24621693
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24621749 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24621693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24622068 - 24622012
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24622068 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24622012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24622387 - 24622331
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24622387 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24622331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24622671 - 24622615
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24622671 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24622615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24622955 - 24622899
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24622955 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24622899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24623558 - 24623502
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24623558 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24623502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24623877 - 24623821
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24623877 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24623821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24624470 - 24624414
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24624470 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24624414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24624789 - 24624733
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24624789 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24624733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24625073 - 24625017
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24625073 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24625017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24625392 - 24625336
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24625392 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24625336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24626965 - 24626909
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24626965 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24626909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24631451 - 24631395
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24631451 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24631395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24631770 - 24631714
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24631770 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24631714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24632054 - 24631998
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24632054 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24631998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24632338 - 24632282
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24632338 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24632282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24632657 - 24632601
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24632657 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24632601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24632941 - 24632885
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24632941 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24632885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24633225 - 24633169
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24633225 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24633169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24633544 - 24633488
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24633544 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24633488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24633863 - 24633807
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24633863 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24633807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24634147 - 24634091
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24634147 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24634091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24634750 - 24634694
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24634750 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24634694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24638829 - 24638773
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24638829 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24638773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24639148 - 24639092
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24639148 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24639092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24623274 - 24623218
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24623274 |
gggcgagagtagtnctaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24623218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 398 - 451
Target Start/End: Complemental strand, 24626351 - 24626298
Alignment:
Q |
398 |
cgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24626351 |
cgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24626298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24627284 - 24627228
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24627284 |
gggcgagagtagtnctaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24627228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24627568 - 24627512
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||| ||||||||||||||| |
|
|
T |
24627568 |
gggcgagagtagtactaggatgggtgacctcctgggaagtcnttgtgttgcacctct |
24627512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24631167 - 24631111
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
24631167 |
gggcgagagtagtactaggatgggtgacctcntgggaagtccttgtgttgcacctct |
24631111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24626034 - 24625978
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| ||||||||||||||| |||||||||| |
|
|
T |
24626034 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccttgttttgcacctct |
24625978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24634466 - 24634410
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24634466 |
gggcgagagtagtgctaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24634410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24638510 - 24638454
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24638510 |
gggcgagagtagtgctaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24638454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 398 - 451
Target Start/End: Complemental strand, 3348113 - 3348060
Alignment:
Q |
398 |
cgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
||||||||||| ||||||||||||||| || ||||||||||||||||||||||| |
|
|
T |
3348113 |
cgagagtagtactaggatgggtgacctcctaggaagtccttgtgttgcacctct |
3348060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 398 - 451
Target Start/End: Complemental strand, 24637890 - 24637837
Alignment:
Q |
398 |
cgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
||||||||||| ||||||||||||||| ||||||||||||||| |||||||||| |
|
|
T |
24637890 |
cgagagtagtactaggatgggtgacctcctgggaagtccttgttttgcacctct |
24637837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24619671 - 24619612
Alignment:
Q |
395 |
gggcgagagtagtattag---gatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||| |||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24619671 |
gggcgagagtagtactagntggatgggtgacctcctgggaagtccttgtgttgcacctct |
24619612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24620819 - 24620760
Alignment:
Q |
395 |
gggcgagagtagtattag---gatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||| |||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24620819 |
gggcgagagtagtactagntggatgggtgacctcctgggaagtccttgtgttgcacctct |
24620760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 410 - 451
Target Start/End: Complemental strand, 24626662 - 24626621
Alignment:
Q |
410 |
taggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24626662 |
taggatgggtgacctcctgggaagtccttgtgttgcacctct |
24626621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 410 - 451
Target Start/End: Complemental strand, 24637555 - 24637514
Alignment:
Q |
410 |
taggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24637555 |
taggatgggtgacctcctgggaagtccttgtgttgcacctct |
24637514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24621142 - 24621082
Alignment:
Q |
395 |
gggcgagagtagtatta----ggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| || ||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24621142 |
gggcgagagtagtactaggatggatgggtgacctcctgggaagtccttgtgttgcacctct |
24621082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 412 - 451
Target Start/End: Complemental strand, 24621444 - 24621405
Alignment:
Q |
412 |
ggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24621444 |
ggatgggtgacctcctgggaagtccttgtgttgcacctct |
24621405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 412 - 451
Target Start/End: Complemental strand, 24625694 - 24625655
Alignment:
Q |
412 |
ggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24625694 |
ggatgggtgacctcctgggaagtccttgtgttgcacctct |
24625655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24635625 - 24635565
Alignment:
Q |
395 |
gggcgagagtagtatta----ggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| || ||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24635625 |
gggcgagagtagtactaggatggatgggtgacctcctgggaagtccttgtgttgcacctct |
24635565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24636326 - 24636266
Alignment:
Q |
395 |
gggcgagagtagtatta----ggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| || ||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24636326 |
gggcgagagtagtactaggatggatgggtgacctcctgggaagtccttgtgttgcacctct |
24636266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24636649 - 24636589
Alignment:
Q |
395 |
gggcgagagtagtatta----ggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| || ||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24636649 |
gggcgagagtagtactaggatggatgggtgacctcctgggaagtccttgtgttgcacctct |
24636589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24639501 - 24639441
Alignment:
Q |
395 |
gggcgagagtagtatta----ggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| || ||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24639501 |
gggcgagagtagtactaggatggatgggtgacctcctgggaagtccttgtgttgcacctct |
24639441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24639824 - 24639764
Alignment:
Q |
395 |
gggcgagagtagtatta----ggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| || ||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24639824 |
gggcgagagtagtactaggnnggatgggtgacctcctgggaagtccttgtgttgcacctct |
24639764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24640147 - 24640087
Alignment:
Q |
395 |
gggcgagagtagtatta----ggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| || ||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
24640147 |
gggcgagagtagtactaggatggatgggtgacctcctgggaagtccttgtgttgcacctct |
24640087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24635302 - 24635242
Alignment:
Q |
395 |
gggcgagagtagtatta----ggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| || ||||||||||||| | |||||||||||||||||||||||| |
|
|
T |
24635302 |
gggcgagagtagtactaggatggatgggtgacctccngggaagtccttgtgttgcacctct |
24635242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 24636972 - 24636912
Alignment:
Q |
395 |
gggcgagagtagtatta----ggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| || ||||||||||||| | |||||||||||||||||||||||| |
|
|
T |
24636972 |
gggcgagagtagtactaggatggatgggtgacctccagggaagtccttgtgttgcacctct |
24636912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1024 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold1024
Description:
Target: scaffold1024; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 395 - 451
Target Start/End: Original strand, 56 - 112
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| ||||||||||| |||||||||||||| |
|
|
T |
56 |
gggcgagagtagtactaggatgggtgacctcctgggaagtccgtgtgttgcacctct |
112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 398 - 447
Target Start/End: Original strand, 2557900 - 2557949
Alignment:
Q |
398 |
cgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcac |
447 |
Q |
|
|
||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
T |
2557900 |
cgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcac |
2557949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 414 - 449
Target Start/End: Complemental strand, 12891645 - 12891610
Alignment:
Q |
414 |
atgggtgaccttctgggaagtccttgtgttgcacct |
449 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
12891645 |
atgggtgaccttctgggaagtccttgtgttgcacct |
12891610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 395 - 451
Target Start/End: Original strand, 14903161 - 14903217
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
451 |
Q |
|
|
|||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
14903161 |
gggcgagagtagtactaggatgggtgacctcctgaaaagtccttgtgttgcacctct |
14903217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 398 - 447
Target Start/End: Complemental strand, 30729467 - 30729418
Alignment:
Q |
398 |
cgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcac |
447 |
Q |
|
|
||||||||| ||||||||||||||||||||| ||||| ||||||||||| |
|
|
T |
30729467 |
cgagagtagcattaggatgggtgaccttctgaaaagtcattgtgttgcac |
30729418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 395 - 443
Target Start/End: Original strand, 16990096 - 16990144
Alignment:
Q |
395 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgtt |
443 |
Q |
|
|
|||||||||||||| ||||||| ||||||| ||||||||||||||||| |
|
|
T |
16990096 |
gggcgagagtagtactaggatgagtgacctattgggaagtccttgtgtt |
16990144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000003; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 410 - 462
Target Start/End: Complemental strand, 42435349 - 42435297
Alignment:
Q |
410 |
taggatgggtgaccttctgggaagtccttgtgttgcacctctcccaccctttt |
462 |
Q |
|
|
||||||| ||||| || |||||| |||||||||||||||||||||||| |||| |
|
|
T |
42435349 |
taggatgagtgacgttatgggaaatccttgtgttgcacctctcccaccatttt |
42435297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 407 - 450
Target Start/End: Complemental strand, 19426053 - 19426010
Alignment:
Q |
407 |
tattaggatgggtgaccttctgggaagtccttgtgttgcacctc |
450 |
Q |
|
|
||||||||||||||||||||||| || |||||| |||||||||| |
|
|
T |
19426053 |
tattaggatgggtgaccttctggaaaatccttgcgttgcacctc |
19426010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 424 - 455
Target Start/End: Complemental strand, 38580369 - 38580338
Alignment:
Q |
424 |
ttctgggaagtccttgtgttgcacctctccca |
455 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
38580369 |
ttctgggaagtccttgtgttgcacctctccca |
38580338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 13642504 - 13642566
Alignment:
Q |
399 |
gagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
463 |
Q |
|
|
|||||||||| || |||||||||||| |||||| ||||||||||||| ||| ||||||||||| |
|
|
T |
13642504 |
gagagtagtactaagatgggtgacctcatgggaaatccttgtgttgca--tcttccacccttttt |
13642566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University