View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10121_low_23 (Length: 456)
Name: NF10121_low_23
Description: NF10121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10121_low_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 408; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 408; E-Value: 0
Query Start/End: Original strand, 14 - 449
Target Start/End: Original strand, 3775721 - 3776156
Alignment:
| Q |
14 |
ggaagaacaagaattctgcttctcactttcgccaaataactgtacctgaaacagctgttcagaattctctatccgactcgccaaacggagtccatcatcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3775721 |
ggaagaacaagaattctgcttctcactttcgccaaataactgtacctgaaacagctgttcagaattctctatccgactcgccaaacggagtccatcatcc |
3775820 |
T |
 |
| Q |
114 |
ttcactaaactgtaatggcacagtctttacattcaggaccgatacccctttgtgtgaatcaatggaatctgcattgaaccttgctgatcaaggagttaat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3775821 |
ttcactaaactgtaatggcacagtctttacattcaggaccgatacacctttgtgtgaatcaatggaatctgcattgaaccttgctgatcaaggagttaat |
3775920 |
T |
 |
| Q |
214 |
atttccccgaaaaacggattcattagaccggaagcactgcagattcatgtaccctatgttggggaagaaaagagtgatgaacattccatcaaatcttctg |
313 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3775921 |
atttcccagaaaaatggattcattagaccggaagcactgcggattcatgtaccctatgttggggaagaaaagagtgatgaacattccatcaaatcttctg |
3776020 |
T |
 |
| Q |
314 |
acacatcaacaacgctgacagaagatgcagctgccagcagttctgttgaacaagttatgccaaattgtcaaagcttccaaccgcaagttccgtactatcc |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3776021 |
acacatcaacaacgctgacagaagatgcagctgccagcagttctgttgaacaagttatgccaaattgtcaaagcttccaaccacaagttccgtactatcc |
3776120 |
T |
 |
| Q |
414 |
cagtgccccttggcttttgccgtgatgtccatctca |
449 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
3776121 |
cagtgccccttggcttttgccgtggagtccatctca |
3776156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University