View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10121_low_27 (Length: 440)
Name: NF10121_low_27
Description: NF10121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10121_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 20 - 231
Target Start/End: Original strand, 40855051 - 40855262
Alignment:
| Q |
20 |
agttgtacatcctctaatattattgtatatgtgtgatcttccccctacctgtggtgtaatgattacagtctgcatctaattaatgttgttgttgttgttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
40855051 |
agttgtacatcctctaatattattgtatatgtgtgatcttccccctacctgtggtgtaatgattacagtccgtatctaattaatgttgttgttgttgttc |
40855150 |
T |
 |
| Q |
120 |
taactatttttatatttgttgatagttgtcaacttaacactggtagatctgcctggtttgacaaagttcgctgtaggtacactttcttttcattatcttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
40855151 |
taactatttttatatttgttgatagttgtcaacttaacactggtagatctgcctggtttgacaaagttcgctgtaggtacgctttattttcattatcttt |
40855250 |
T |
 |
| Q |
220 |
tcacaaataatc |
231 |
Q |
| |
|
|||||||||||| |
|
|
| T |
40855251 |
tcacaaataatc |
40855262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 298 - 424
Target Start/End: Original strand, 40855329 - 40855455
Alignment:
| Q |
298 |
cagagggacaaccagaaagtattgttcaagacattgaaagcttgatccactcatatgttgataaggtagttaaaattaaaagactagcctatacaacttc |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40855329 |
cagagggacaaccagaaagtattgttcaagacattgaaagcttgatccactcatatgttgataaggtagttaaaattaaaagactagcctatacaacttc |
40855428 |
T |
 |
| Q |
398 |
ggttccctttggctatctgatgtgatg |
424 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
40855429 |
ggttccctttggctatctgatgtgatg |
40855455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University