View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10121_low_34 (Length: 410)
Name: NF10121_low_34
Description: NF10121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10121_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 3e-73; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 142 - 289
Target Start/End: Complemental strand, 30410450 - 30410303
Alignment:
| Q |
142 |
tcacttctgtcaaacatgaacaaaagaatgtggatgtgcctaccgcctccgattttgctgcctctttcaatttcaagcatcaagctaacttggatgctga |
241 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30410450 |
tcacttctgtcaaacatgaacaagagaacgtggatgtgcctaccgcctccgattttgctgcctctttcaatttcaagcatcaagctaacttggatgctga |
30410351 |
T |
 |
| Q |
242 |
ttctttatctccatattttgcttctctaaatcaggtgccttttgtatt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30410350 |
ttctttatctccatattttgcttctctaaatcaggtgccttttgtatt |
30410303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 18 - 137
Target Start/End: Complemental strand, 30410526 - 30410407
Alignment:
| Q |
18 |
gtgttttaggccatgccatctcccaccaccgggagtttcgccatgcttccacctctcacttataaaggatcaatgctcacttctgtcaaacatgaacaac |
117 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30410526 |
gtgtttcaggccatgccatctcccaccaccgggagtttcgccatgcttccacctctcacttataaaggatcaatgctcacttctgtcaaacatgaacaag |
30410427 |
T |
 |
| Q |
118 |
agaacgtggatgtgcctacc |
137 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
30410426 |
agaacgtggatgtgcctacc |
30410407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 18 - 116
Target Start/End: Complemental strand, 30398134 - 30398036
Alignment:
| Q |
18 |
gtgttttaggccatgccatctcccaccaccgggagtttcgccatgcttccacctctcacttataaaggatcaatgctcacttctgtcaaacatgaacaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || || | || |||||| ||||||| ||||||||| ||||| |
|
|
| T |
30398134 |
gtgttttaggccatgccatctcccaccaccgggagtttcaccatgcttccacctctcgctgatgagggctcaatgatcacttcggtcaaacataaacaa |
30398036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 199 - 277
Target Start/End: Complemental strand, 30398022 - 30397944
Alignment:
| Q |
199 |
ctgcctctttcaatttcaagcatcaagctaacttggatgctgattctttatctccatattttgcttctctaaatcaggt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||| || || |||| ||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
30398022 |
ctgcctctttcaatttcaagcatcaagccaattttgatgttgattctttatctccctatttttcttctctaaatcaggt |
30397944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University