View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10121_low_35 (Length: 404)
Name: NF10121_low_35
Description: NF10121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10121_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 19 - 385
Target Start/End: Original strand, 47503181 - 47503552
Alignment:
Q |
19 |
acaaggcaattcatggagaggatgcttttgccttgcatagtgaggcaactaaatttgtgaacattaagcgcaatcaggtttatgatacacaagatttctc |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47503181 |
acaaggcaattcatggagaggatgcttttgccttgcatagtgaggcaactaaatttgtgaacattaagcgcaatcaggtttatgatacacaagatttctc |
47503280 |
T |
 |
Q |
119 |
gtccattcccgagtctagatcattaggtgaacttcaaatggtatgaaatcaaccagtaacatatgtt----tagctaatataatgtcttgtgtttgaata |
214 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| || ||||||| |
|
|
T |
47503281 |
gtccattcccgagtctagatcattaggtgaacttcaaatggtatgaaatcaaccagtaacatatgtttaactaactaatataatgtcttatgattgaata |
47503380 |
T |
 |
Q |
215 |
aatgttgttaccaccgtcgattgtaatatattttatggacgttaacttcacacctacaataccaaa-ttttcaaaaaataccaaatttttcaagtttgcg |
313 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
47503381 |
aatgttgttacctccgtcgattgtaatatattttatggacgttaacttcacacctacaataccaaatttttcaaaaaataccaaatttttcaagtttgcg |
47503480 |
T |
 |
Q |
314 |
tgatatcggagcgaagggtaatattaaagtttattagagtcacactttgtcaaggttcttggacatttgaag |
385 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47503481 |
tgatatcggagttaagggtaatattaaagtttattagagtcacactttgtcaaggttcttggacatttgaag |
47503552 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University