View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10121_low_59 (Length: 318)
Name: NF10121_low_59
Description: NF10121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10121_low_59 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 61 - 176
Target Start/End: Complemental strand, 11582858 - 11582741
Alignment:
| Q |
61 |
atatatagtatatcatttcatgccatttatata--aatgttgcctttaaattcaaaccgttaaataattttacatcacagatttcatatacttgatctat |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11582858 |
atatatagtatatcatttcatgccatttatatataaatgttgcctttaaattcaaaccgttaaataattttacatcacatatttcatatacttgatctag |
11582759 |
T |
|
| Q |
159 |
cgttattgataagcaaac |
176 |
Q |
| |
|
| ||||| |||||||||| |
|
|
| T |
11582758 |
ctttattcataagcaaac |
11582741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 11583818 - 11583771
Alignment:
| Q |
1 |
aaaaaagctgattgctactgtgacaaaataaacaagcacagtgagtga |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11583818 |
aaaaaagctgattgctactgtgacaaaataaacaagcacaatgagtga |
11583771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University