View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10121_low_61 (Length: 310)
Name: NF10121_low_61
Description: NF10121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10121_low_61 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 14 - 303
Target Start/End: Original strand, 11612657 - 11612946
Alignment:
| Q |
14 |
caaaggataagcttacaagggttatcttagaaattgcttaatgttaaagattttgttatggttggttggtatgactgtgagagtggacctgttacagttc |
113 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11612657 |
caaaggataagcttaaaagggttacattagaaattgcttaatgttaaagattttgttatggttggttggtgtgactgtgagagtggacctgttacagttc |
11612756 |
T |
 |
| Q |
114 |
agctggtctttatcttcaacatgaagccttttttaattttcatgtttctatatagtttggtatgatgtaatctagcttctgcttttgtcctcactctaat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612757 |
agctggtctttatcttcaacatgaagccttttttaattttcatgtttctatatagtttggtatgatgtaatctagcttctgcttttgtcctcactctaat |
11612856 |
T |
 |
| Q |
214 |
tgattttgtaaattatttccattgatctagtttcttctgcatgtttggtttgccttttagtcttaaggtccttttctttttcctttgctt |
303 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612857 |
tgattttgtaaagtatttccattgatctagtttcttctgcatgtttggtttgccttttagtcttaaggtccttttctttttcctttgctt |
11612946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University