View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10121_low_69 (Length: 269)
Name: NF10121_low_69
Description: NF10121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10121_low_69 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 16 - 261
Target Start/End: Complemental strand, 55300247 - 55300002
Alignment:
| Q |
16 |
tcttcatccatgatattgatgacaaccaccaatgaccactgttcttcctcctccgtgcggaacgtgacatattgtggcgagtaggcgatatcatgtgacg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55300247 |
tcttcatccatgatattgatgacaaccaccaatgaccactgttcttcctcctccgtgcggaacgtgacatattgtggcgagtaggcgatatcatgtgacg |
55300148 |
T |
|
| Q |
116 |
atctccaacagattgcttccgagtcgggctaggtactttcattctctctttctttctttctcttactctaccattcaaccaataacatttcattactatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55300147 |
atctccaacagattgcttccgagtcgggctaggtactttcattctctctttctttctttctcttactctaccattcaaccaataacatttcattactatt |
55300048 |
T |
|
| Q |
216 |
atacttgtgccgtctctagtcggagcttccaagaaattcctatgct |
261 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
55300047 |
atacttgtgccgtctctagttggagcttccaagaaattcctatgct |
55300002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University