View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10121_low_79 (Length: 246)
Name: NF10121_low_79
Description: NF10121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10121_low_79 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 13 - 233
Target Start/End: Complemental strand, 1786872 - 1786650
Alignment:
Q |
13 |
ctaacacaagacttcttttaccacaattattaatctacatgtcatgttgtaccaaaaccgcaaatta--atatatgtttcgattactagtgaatttgaca |
110 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||| |||||||| ||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
T |
1786872 |
ctaacacaagactccttttaccacaattattaatctacgtgtcatgtcgtaccaaaaccaaaaattagtatatatgtttcgattactagtgaatttgaca |
1786773 |
T |
 |
Q |
111 |
aaattacggtatcacatttttaacaaaatcacggtgtcatcatataattctgtcaactttatggcaattctaagcattatactcaatgtgtttaagatgt |
210 |
Q |
|
|
||||| || ||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
T |
1786772 |
aaatttcgatatcacaattttaacaaaatcaaggtgtcatcatataattctgtcaactttatggcaattctaagcattgtactcaatttgtttaagatgt |
1786673 |
T |
 |
Q |
211 |
taataaagattgaccttgatgtc |
233 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
1786672 |
taataaagattgaccttgatgtc |
1786650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University