View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10121_low_80 (Length: 246)
Name: NF10121_low_80
Description: NF10121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10121_low_80 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 31589607 - 31589372
Alignment:
Q |
1 |
gcaaacaaggttgacaaagaaaagacgagaccacaccacatgcagagagctaactaagctttatgcgtgaagaataccgtgt----aatttgtaggtgaa |
96 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
T |
31589607 |
gcaaacaaggttgacaaagaaaagacgagaccacaccacatgcagagagctaactaagctttatgcgtgaagaataccatgtgttcaatttgtaggtgaa |
31589508 |
T |
 |
Q |
97 |
gcatcaatcagtgaagaaagctgggtgctaagtggaaaaggagaaaacaaatgttgcctgcggttttgtatttttggtgactggcggacaatattttgat |
196 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31589507 |
gcatcaatcagtgaagaaagctgggtgctaagtggaaaaggagaaaacaaatgttgcctgcggttttgtatttttggtgactggcggacaatattttgat |
31589408 |
T |
 |
Q |
197 |
tttgccaagagagatcttctgttctttctttgatgt |
232 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
31589407 |
tttgccaagagagatcttctgttctttctttgatgt |
31589372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University