View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10121_low_82 (Length: 243)
Name: NF10121_low_82
Description: NF10121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10121_low_82 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 123 - 226
Target Start/End: Complemental strand, 6010447 - 6010344
Alignment:
| Q |
123 |
taggagcaactaatgattttaattatctctatattgtcaggcactgaacttgttgggagcttctttgacttcttccaaagaggctttgacagaaggcttg |
222 |
Q |
| |
|
||||||||| ||||||||| |||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6010447 |
taggagcaaataatgatttaaattatatctatattgtcaggcactgaacctgttgggagcttctttgacttcttccaaagaggctttgacagaaggcttg |
6010348 |
T |
|
| Q |
223 |
ttct |
226 |
Q |
| |
|
|||| |
|
|
| T |
6010347 |
ttct |
6010344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University