View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10121_low_85 (Length: 241)
Name: NF10121_low_85
Description: NF10121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10121_low_85 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 33690425 - 33690185
Alignment:
| Q |
1 |
gagagagaccatttaattttaatttcttctttaacacgtattattcctttccaaattcttgttcatgcataaattgtcttttatttaccatgtcgtaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33690425 |
gagagagaccatttaattttaatttcttctttaacacgtattattcctttccaatttcttgttcatgtataaattgtcttttatttaccatgtcgtaatt |
33690326 |
T |
 |
| Q |
101 |
gtatttgttagtaaacgattgatacacacaacacacatttggctttgatctttgaagagaaaggatcttgtcggggactaagattgtgtgttcaaattag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
33690325 |
gtatttgttagtaaacgattgatacacacaacacacatttggctttgatctttgaagagaaaggatcttgtcggggactaagattgtgtgttcaaatgag |
33690226 |
T |
 |
| Q |
201 |
agaatagaagggaccagtgacgttagattattaactttata |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33690225 |
agaatagaagggaccagtgacgttagattattaactttata |
33690185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University