View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10121_low_90 (Length: 240)
Name: NF10121_low_90
Description: NF10121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10121_low_90 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 11583877 - 11584097
Alignment:
| Q |
1 |
tttcataaattcctgctcatttatttttgtcttctaatatccaaaagttcatatttgacgtggaaaaccctcttattcgaaggaaaaaatcattggacaa |
100 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11583877 |
tttcataaattcctgctcgtttattattgtcttctaatatccaaaagttcatatt-gacgtggaaaaccctcttattcgaaggaaaaaatcattggacaa |
11583975 |
T |
|
| Q |
101 |
acaacaaaaagtatttagatgctagatacaattgaggaaacattgagaagaaattaataatttaaaaaacttttgagattttcatttgttctatccattc |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | | ||||||| |
|
|
| T |
11583976 |
acaacaaaaagtatttagatgctacatacaattgaggaaacattgagaagaaattaataatttaaaaaacttttgatattttcatttgctttgtccattc |
11584075 |
T |
|
| Q |
201 |
ttccagtattcttatccatctt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
11584076 |
ttccagtattcttatccatctt |
11584097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University