View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10121_low_94 (Length: 234)
Name: NF10121_low_94
Description: NF10121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10121_low_94 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 19 - 219
Target Start/End: Complemental strand, 27974607 - 27974404
Alignment:
| Q |
19 |
catacacgcttctcacaaactctttctcggtctgcagcgccaaaatatccttctgaagtttgtcgatctcacctattgcttcagctttggtaagatctga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
27974607 |
catacacgcttctcacaaactctttctcggtctgcagcgccaaaatatccttctgaagtttgtcgatctcgcctattgcttcagttttggtaagatctga |
27974508 |
T |
 |
| Q |
119 |
tcctggagttgttggaataaattttgaaa---aagttctcttagttggaccttttcgagatagtaacatcgaaggacttcgaaaatctttctttggaacc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27974507 |
tcctggagttgttggaataaattttgaaaaagaagttctcttagttggaccttttcgggatagcaacatcgaaggacttcgaaaatctttctttggaacc |
27974408 |
T |
 |
| Q |
216 |
tttg |
219 |
Q |
| |
|
|||| |
|
|
| T |
27974407 |
tttg |
27974404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University