View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10121_low_97 (Length: 234)
Name: NF10121_low_97
Description: NF10121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10121_low_97 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 13 - 216
Target Start/End: Original strand, 44976469 - 44976675
Alignment:
| Q |
13 |
agcaaaggtgagggaagaatccaaagctgtcatcctcattcattatgaaagtgattttgtcacttggctaagttgcttgcagctgatccatctcttgtct |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44976469 |
agcaaaagtgagggaagaatccaaagctgtcatcctcattcattatgaaagtgattttgtcacttggctaagttgcttgcagctgatccatctcttgtct |
44976568 |
T |
 |
| Q |
113 |
gctatgtctgagctatataatgtttgtgttcacgggttcttcatttgtggtg---tcccgtgaacttgctcattttttgggttgaatgttgcattgcatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44976569 |
gctatgtctgagctatataatgtttgtgttcacgggttcttcatttgtggtgtactcccgtgaacttgctcattttttgggttgaatgttgcattgcatg |
44976668 |
T |
 |
| Q |
210 |
gaatcaa |
216 |
Q |
| |
|
||||||| |
|
|
| T |
44976669 |
gaatcaa |
44976675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University