View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10121_low_99 (Length: 230)
Name: NF10121_low_99
Description: NF10121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10121_low_99 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 9 - 206
Target Start/End: Complemental strand, 104983 - 104787
Alignment:
| Q |
9 |
gagaagcaaaggtggaagaaaggtaatttactggctctataaaatccaaaattgtgattccattccaaatgcataatgtagnnnnnnnnnnnnnnnnnnn |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
104983 |
gagaaacaaaggtggaagaaaggtaatttactggctctataaaatccaaaattgtgattccattccaaatgcataatgtagtaatataatataatataat |
104884 |
T |
 |
| Q |
109 |
nnnnntggactatagaaaaagtaagctgtggtcttcttgttacattatatgtatgctcattcatgttagtgttatgcaaaaatagaagcatcatcaac |
206 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
104883 |
ataattggactatagaaaaagtaagctgtggt-ttcttgttacattatatgtatgctcattcatgttagtgttatgcaaaaatagaagcatcatcaac |
104787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University