View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10122_high_2 (Length: 368)
Name: NF10122_high_2
Description: NF10122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10122_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 1 - 356
Target Start/End: Complemental strand, 52245907 - 52245552
Alignment:
| Q |
1 |
cttcatccaatgcatctttgcttcgtgctttaggcttgaaagacaacagtgtcagtattagcagtaccacaacagatcaacggaatagccatggtcatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52245907 |
cttcatccaatgcatctttgcttcgtgctttaggcttgaaagacaacagtgtcagtattagcagtaccacaacagatcaatggaatagccatggtcatgt |
52245808 |
T |
|
| Q |
101 |
aaaacaagagaatgagcctgtggcagattaccttgggcttggacttccctgcgggaatgagttgaggggctcatcgaaccagcccatgacccgtgatctt |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52245807 |
aaaacaagagaatgagcccgtggcagattaccttgggcttggacttccctgcgggaatgagttgaggggctcatcgaaccagcccatgacccgtgatctt |
52245708 |
T |
|
| Q |
201 |
cttggtcttagcatgggattgggtagagaggatgatgatctttctgctttgctcacatcttttggagggaacttggattaacccgcatagacaagagttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52245707 |
cttggtcttagcatgggattgggtagagaggatgatgatctttctgctttgctcacatcttttggagggaacttggattaacccgcatagacaagagttt |
52245608 |
T |
|
| Q |
301 |
tagaaaactggagacaactagttgtagtggcccacccgaagaattttttgttttgc |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52245607 |
tagaaaactggagacaactagttgtagtggcccacccgaggaattttttgttttgc |
52245552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University