View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10122_high_6 (Length: 253)
Name: NF10122_high_6
Description: NF10122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10122_high_6 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 215
Target Start/End: Original strand, 20421061 - 20421258
Alignment:
| Q |
18 |
cttatcctcacgtataaatttggatttaggaaagtatatgtgttcagttagtatatgagttcggtttttatgcttacttgcttagcaatttccgtgtgaa |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20421061 |
cttatcctcacatataaatttggatttaggaaagtatatgtgttcagttagtatatgagttccgtttttatgcttacttgcttagcaatttctgtgtgaa |
20421160 |
T |
|
| Q |
118 |
aaagaagataacttgatccttattggttgatcagaatcactttcactatgaaaatgaatttcagcagagtaactgatttgaatttttcttgttataga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20421161 |
aaagaagataacttgatccttattggttgatcagaatcactttcactatgaaaatgaatttcagcagagtaactgatttgaatttttcttgttataga |
20421258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 56 - 91
Target Start/End: Original strand, 20421005 - 20421040
Alignment:
| Q |
56 |
tgtgttcagttagtatatgagttcggtttttatgct |
91 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
20421005 |
tgtgttcagttagtatatgagttccgtttttatgct |
20421040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 19 - 215
Target Start/End: Complemental strand, 9884854 - 9884658
Alignment:
| Q |
19 |
ttatcctcacgtataaatttggatttaggaaagtatatgtgttcagttagtatatgagttcggtttttatgcttacttgcttagcaatttccgtgtgaaa |
118 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9884854 |
ttatcctcacatataaatttggagttaggaaagtatatgtgttcagttagtatatgaattctgtttttatgcttacttgcttagcaatttctgtgtgaaa |
9884755 |
T |
|
| Q |
119 |
aagaagataacttgatccttattggttgatcagaatcactttcactatgaaaatgaatttcagcagagtaactgatttgaatttttcttgttataga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9884754 |
aagaagataacttgatccttattggttggtcagaaacactttcactatgaaaatgaatttcagcagagtaactgatttgaatttttcttgttataga |
9884658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 111849 - 111898
Alignment:
| Q |
166 |
tgaaaatgaatttcagcagagtaactgatttgaatttttcttgttataga |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
111849 |
tgaaaatgaatttcagcagagtaactaatttgtatttttcttgttataga |
111898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 135034 - 135083
Alignment:
| Q |
166 |
tgaaaatgaatttcagcagagtaactgatttgaatttttcttgttataga |
215 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
135034 |
tgaaaatgaatttcagcagagtaactggtttgtatttttcttgttataga |
135083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University