View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10122_low_12 (Length: 309)
Name: NF10122_low_12
Description: NF10122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10122_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 40885749 - 40886008
Alignment:
| Q |
1 |
caattattatatgtaaaacagatggatctatcaccactccaacagtatagtattagtatcactgttggtgtttttgtgnnnnnnnattaagtcctttgta |
100 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40885749 |
caattattatatgtaaaacagatggatgttgcaccactccaacagtatagtattagtatcactgttggtgtttttgtgtttttt-attaagtcctttgta |
40885847 |
T |
|
| Q |
101 |
ttggtattaggtcatataaaattgatttatgacctaatgctttgtcctagtatatgatcacatgagatccnnnnnnngtaaggttactgctatgattgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40885848 |
ttggtattaggtcatataaaattgatttatgacctaatgctttgtcctagtatatgatcacatgagatcctttttttgtaaggttactgctatgattgtg |
40885947 |
T |
|
| Q |
201 |
gaccgatatttatggttcattattatgaagtttaatgtgatcctcgttattttgttttgaa |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40885948 |
gaccgatatttatggttcattattatgaagtttaatgtgatcctcgttattttgttttgaa |
40886008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University