View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10122_low_20 (Length: 253)
Name: NF10122_low_20
Description: NF10122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10122_low_20 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 16 - 253
Target Start/End: Original strand, 40885455 - 40885692
Alignment:
| Q |
16 |
gattttaggtgtaaactacaattttgatacaaatgaagggatgatatacatctcaggaaaagcagatccacaaaaaatattgaagaggattgcaaaacat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40885455 |
gattttaggtgtaaactacaattttgatacaaatgaagggatgatatacatctcaggaaaagcagatccacaaaaaatattgaagaggattgcaaaacat |
40885554 |
T |
 |
| Q |
116 |
caaaagaaagtagaactttgttgggttcggactggagaacaatattcctatgggaacaatatgtctgcttaccctacaacatatcccagtggatactatc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40885555 |
caaaagaaagtagaactttgttgggttcggactggagaacaatattcctatgggaacaatatgtctgcttaccctacaacatatcccagtggatactatc |
40885654 |
T |
 |
| Q |
216 |
cccctccatcagggtcctactatcagaattttgatccc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40885655 |
cccctccatcagggtcctactatcagaattttgatccc |
40885692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University