View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10122_low_23 (Length: 250)
Name: NF10122_low_23
Description: NF10122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10122_low_23 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 11 - 250
Target Start/End: Complemental strand, 37723793 - 37723559
Alignment:
| Q |
11 |
cacagactaattgcttgatttttactttcattgtcttctaaggacttagattctgcttgannnnnnnnnnnnnnnnnnnnnnnnattgattcaataggtt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37723793 |
cacagactaattgcttgatttttactttcattgtcttctaaggacttagattctgcttgattttttcttttattgtttattttcattgattcaataggtt |
37723694 |
T |
|
| Q |
111 |
ggttatctatggatttatcggatccggctccttcaatcacttctgagtgagagtcaagtaaatgatatgatatcaactattggtaaacaaattaattatt |
210 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
37723693 |
ggttatcaatggatttatcggatccggctccttcaatcactactgagtgagagtcaagtga-----atgatatcaactattggtaaacaaattaattatt |
37723599 |
T |
|
| Q |
211 |
ggtattatacacatgcataagcataacaaatcataatagt |
250 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37723598 |
ggcattatacacatgcataagcataacaaatcataatagt |
37723559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University