View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10122_low_24 (Length: 240)
Name: NF10122_low_24
Description: NF10122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10122_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 16 - 201
Target Start/End: Original strand, 37723347 - 37723527
Alignment:
| Q |
16 |
catcttcaacactgcacttgnnnnnnncttttgattgtttatgaatgatttgtagctgataagtatgtctcggtaaagctgaaagctagtagtaatttac |
115 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37723347 |
catcttcaacactgcacttgtttttt-cttttgattgtttatgaatgatttgtagccgataagtatgtctcggtaaagctgaaagctagtagtaatttac |
37723445 |
T |
|
| Q |
116 |
agagtgttttttcggtttgatgctcaatacaataggttgatgaagccattc-ttgatcagataaatttgagggttcatctaaagcgg |
201 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37723446 |
agagtgttttttcggtttgatgct-----caataggttgatgaagccattctttgatcagataaatttgagggttcatctaaagcgg |
37723527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 211 - 240
Target Start/End: Original strand, 37723541 - 37723570
Alignment:
| Q |
211 |
tcaaacaatagtattttaactattatgatt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37723541 |
tcaaacaatagtattttaactattatgatt |
37723570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University