View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10122_low_8 (Length: 346)
Name: NF10122_low_8
Description: NF10122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10122_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 6e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 12 - 158
Target Start/End: Original strand, 24195372 - 24195518
Alignment:
| Q |
12 |
ataggaccacggaataattctggatttatgatgggtaggaaaaacggtggtggtatgtggaggttgatggtggtttcctatgtatgaagaaaggtatttg |
111 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
24195372 |
ataggaccacggaataattctgaatttatgatgggtaggaaaagcggtggtggtatgtggaggttgatggtggtttcctatgtatgaagaaaggtattag |
24195471 |
T |
|
| Q |
112 |
ggtggggatgctacggtactaaatttgcctaaaattttgccataaca |
158 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24195472 |
ggtggggatgctacggtgctaaatttgcctaaaattttgccataaca |
24195518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 282 - 331
Target Start/End: Original strand, 24197211 - 24197260
Alignment:
| Q |
282 |
cggaagaataataattttccattgccttgtgatgccatttgtattcataa |
331 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
24197211 |
cggaagaataataattttctattgccttctgatgccatttgtattcataa |
24197260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University