View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10123_low_11 (Length: 318)
Name: NF10123_low_11
Description: NF10123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10123_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 31406480 - 31406263
Alignment:
Q |
1 |
tcgaagtgctagtagccagaaataaaactttgtctttgttgtttgttagtcactattatgggcaggttgatgtgactctctatgagcttttttgtcatta |
100 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
31406480 |
tcgaagtgctagtaaccagaaataaaactttgtctttgttgtttgttagtagtgattatgggcaggttgatgtgactctgtatgagcttttttgtcatta |
31406381 |
T |
 |
Q |
101 |
atatgaatgaatgtgtttgccaactccttgcatttctttctcctccactaatatttatgattgttttttaatgaaaagggaatactattaaggggacaga |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31406380 |
atatgaatgaatgtgtttgccaactccttgcatttctttctcctccactaatatttatgattgttttttaatgaaaagggaatactattaaggggacaga |
31406281 |
T |
 |
Q |
201 |
attcccccaatcctccca |
218 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
31406280 |
attcccccaatcctccca |
31406263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 216 - 304
Target Start/End: Complemental strand, 31405891 - 31405803
Alignment:
Q |
216 |
ccaactggatatttctgcatcttagatagggtttcctactattttcctctatactagcacttgatcaaggccttcacatttggtctgtg |
304 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31405891 |
ccaactggatatttctgcatcttagatagggtttcctactattttcctctatactagcacttgatcaaggccttcacatttggtctgtg |
31405803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University