View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10123_low_13 (Length: 294)
Name: NF10123_low_13
Description: NF10123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10123_low_13 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 136 - 294
Target Start/End: Complemental strand, 31406740 - 31406583
Alignment:
| Q |
136 |
tagaagttgaaataccttgttttcatatatcaattggccattattaactgttttggtgttgaaattgcagggtccaacatttggagcaatgatgatttca |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31406740 |
tagaagttgaaataccttgttttcatatat-aattggccattattaactgttttggtgttgaaattgcagggtccaacatttggagcaatgatgatttca |
31406642 |
T |
 |
| Q |
236 |
ggacagaaggcagctcatttggccttgagagcactgggacttccaaatgttgtggatca |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31406641 |
ggacagaaggcagctcatttggccttgagagcactgggacttccaaatgctgtggatca |
31406583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 18 - 138
Target Start/End: Complemental strand, 31406896 - 31406777
Alignment:
| Q |
18 |
ccagtttgctaaatttatgttcagttgttcatggaatctttcttgtcctttctgcaattcttcttttgattattactttatttcatttggataaccaact |
117 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
31406896 |
ccagtctgctaaatttatgttcaattgttcatggaatctttcttgtcctttatgcaattcttcttttcattattacttta-ttcatttggataaccaact |
31406798 |
T |
 |
| Q |
118 |
gagattcatgtaatgcgctag |
138 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
31406797 |
gagattcatgtaatgcgctag |
31406777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 204 - 263
Target Start/End: Complemental strand, 47480653 - 47480594
Alignment:
| Q |
204 |
agggtccaacatttggagcaatgatgatttcaggacagaaggcagctcatttggccttga |
263 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||| || || |||||||| |||| |
|
|
| T |
47480653 |
agggtccaacatttggggcaatgatgatatcaggacagaaagctgcacatttggcattga |
47480594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University