View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10123_low_14 (Length: 285)
Name: NF10123_low_14
Description: NF10123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10123_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 275
Target Start/End: Complemental strand, 8176515 - 8176235
Alignment:
| Q |
1 |
caggttggatgagatgcgcttctgtgcagtgaggcacgcatgaagtcttctatgttttcttgaatgacacggattatcgattaatgtgtagtcatgcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
8176515 |
caggttggatgagatgcgcttctgtgcagtgaggcacgcatgaaatcttctatgttttcttgaatgacgtggattatcggttaatgtgtagtcatgcatt |
8176416 |
T |
 |
| Q |
101 |
ggatctatgatgtgggttgaggcccattccgaaacaattgccccaagcccttattgtctttatgacataagaagcttcagaaggagacaaccttgataac |
200 |
Q |
| |
|
|||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8176415 |
ggatttgtgatgtgggttgaggcccattccgaaacaattgccccaagcccttattgtctttatgacataagaagcttcagaaggagacaagcttgataac |
8176316 |
T |
 |
| Q |
201 |
aacttatgactttgggcagagaatagttgagacatgtgcacctccgtcttt------atgatgcgttttgatattcctttg |
275 |
Q |
| |
|
||||||||||||||||||||| |||||||||| | |||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
8176315 |
aacttatgactttgggcagagcatagttgagaaaagtgcacctccgtgtttatggagatgatgcgttttgatattcctttg |
8176235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 141 - 177
Target Start/End: Original strand, 11748480 - 11748516
Alignment:
| Q |
141 |
ccccaagcccttattgtctttatgacataagaagctt |
177 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
11748480 |
ccccaagcccttatcgtctttatgacgtaagaagctt |
11748516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University