View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10123_low_16 (Length: 250)
Name: NF10123_low_16
Description: NF10123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10123_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 43037131 - 43036892
Alignment:
| Q |
1 |
tagaaagggtgtctttcaagtttgctttaggtctaaatagatgttaagcgccttgaattggcacaatagaaatagagaaaatggtacggacttccatatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43037131 |
tagaaagggtgtctttcaagtttgctttaggtctaaatagatgttaagcgccttgaattggcacaatagaaatagagaaaatggtacggacttccatatg |
43037032 |
T |
|
| Q |
101 |
agtcgaatgcaaaattttataagaattttagagtaaatgtttgaacattgagcttaaaggagggatacattgaaaactgaacaattgaacatattattga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43037031 |
agtcgaatgcaaaattttataagaatttcagagtaaatgtttgaacattgagcttaaaggagggatacattgaaaactgaacaattgaacatcttattga |
43036932 |
T |
|
| Q |
201 |
actcaaaagctgcataaatcgttgtcattgcgcatctctg |
240 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43036931 |
acttaaaagctgcataaatcgttgtcattgcgcatctctg |
43036892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University