View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10123_low_21 (Length: 239)
Name: NF10123_low_21
Description: NF10123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10123_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 43487045 - 43486826
Alignment:
| Q |
1 |
caactagtttatgttgtcaatttttcgttcgacagctacacatgggcgtcaatggttcttctttagaagagagattgcttcaaaatttagcgattgttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43487045 |
caactagtttatgttgtcaatttttcgttcgacagctacacatgggcgtcaatggttcttctttagaagagagattgcttcaaaatttagcgattgttgc |
43486946 |
T |
|
| Q |
101 |
atcaattggaagaagaacacatcatgttggtcgaagggaaggacaacaaattcgaccatctggtcatgaaagagaagacaatctaaatgcaattcgtatg |
200 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43486945 |
atcaatcg---gaagaacacatcatgttggtcgaagggaaggacaacaaattcgaccatctggtcatgaaagagaagacaatctaaatgcaattcatatg |
43486849 |
T |
|
| Q |
201 |
agcagtcaatctactccaataac |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43486848 |
agcagtcaatctactccaataac |
43486826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University