View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10123_low_22 (Length: 238)
Name: NF10123_low_22
Description: NF10123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10123_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 24 - 233
Target Start/End: Complemental strand, 33496548 - 33496339
Alignment:
| Q |
24 |
aacttttcctgcctttttggtggcaagaaggttactagatcccctagtttttggtgagtaccctgctgagatgcgctctattcttgggaaccggttgcca |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33496548 |
aacttttcctgcctttttggtggcaagaaggttactagatcccctagtttttggtgagtaccctgctgagatgcgctctattcttgggaaccggttgcca |
33496449 |
T |
 |
| Q |
124 |
aagatctctacgaaggagaagagtctcctaagaggcagcctggacttcattggcatcaataactatggagctctctatgccaaggattgctacctctctg |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33496448 |
aagatctctacgaaggagaagagtctcctaagaggcagcctggacttcattggcatcaataactatggagctctctatgccaaggattgctacctctcta |
33496349 |
T |
 |
| Q |
224 |
cttctccact |
233 |
Q |
| |
|
||| |||||| |
|
|
| T |
33496348 |
cttgtccact |
33496339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 51 - 222
Target Start/End: Original strand, 33519435 - 33519606
Alignment:
| Q |
51 |
aaggttactagatcccctagtttttggtgagtaccctgctgagatgcgctctattcttgggaaccggttgccaaagatctctacgaaggagaagagtctc |
150 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| || |||||| | | |||| | ||||||||||| ||| |
|
|
| T |
33519435 |
aaggttactagatcccctagtttttggcgagtaccctgctgatatgcgctctattcttgggagccagttgcctaggttctcatctaaggagaagagcctc |
33519534 |
T |
 |
| Q |
151 |
ctaagaggcagcctggacttcattggcatcaataactatggagctctctatgccaaggattgctacctctct |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
33519535 |
ctaagaggcagcctggacttcattggcatcaataactacggggctctctatgccaaggattgctacctctct |
33519606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University