View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10123_low_6 (Length: 365)

Name: NF10123_low_6
Description: NF10123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10123_low_6
NF10123_low_6
[»] chr5 (2 HSPs)
chr5 (119-185)||(28039871-28039938)
chr5 (313-365)||(28039663-28039715)


Alignment Details
Target: chr5 (Bit Score: 37; Significance: 0.000000000008; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 119 - 185
Target Start/End: Complemental strand, 28039938 - 28039871
Alignment:
Q  119 gaacataaaattataatatctctaaacaaaaaggataaaatcaaaccat---gcttttaactatccaatt 185  Q
    |||||||||||||||||||||||||||||||  |||||||| |||||||   |||| |||||||||||||    
T  28039938 gaacataaaattataatatctctaaacaaaa--gataaaattaaaccatgcggcttctaactatccaatt 28039871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 313 - 365
Target Start/End: Complemental strand, 28039715 - 28039663
Alignment:
Q  313 atatttcaacaatgaccaaaaataaggaccaaacacaatttctttctctctct 365  Q
    |||||||||||||||  ||||| || ||||||||||| |||||||||||||||    
T  28039715 atatttcaacaatgataaaaaacaatgaccaaacacattttctttctctctct 28039663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University