View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10124_14 (Length: 315)
Name: NF10124_14
Description: NF10124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10124_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 164 - 241
Target Start/End: Complemental strand, 3688804 - 3688727
Alignment:
| Q |
164 |
ttcaccttcacgagaagagctttgataatcagaaatagcagaagaacacctagaagacccattagatttcacttttcc |
241 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3688804 |
ttcaccttcaggagaagagctttgataatcagaaatagcagaagaacacctagaagacccattagatttgacttttcc |
3688727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 238 - 311
Target Start/End: Complemental strand, 3688694 - 3688621
Alignment:
| Q |
238 |
ttccctcattcttctcactcccaaacgaaaacggtaatgatgatccataccgcaatgtttcatattgttgcggc |
311 |
Q |
| |
|
|||| |||||||| ||||||||||||||||| ||||| ||| ||| ||||||||| |||||||||||||||||| |
|
|
| T |
3688694 |
ttccttcattcttttcactcccaaacgaaaatggtaacgataatctataccgcaaagtttcatattgttgcggc |
3688621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University