View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10124_low_10 (Length: 365)
Name: NF10124_low_10
Description: NF10124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10124_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 7e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 16 - 170
Target Start/End: Original strand, 43561490 - 43561644
Alignment:
| Q |
16 |
gttgcagcaggcacggaaaaggagatatatgttcaaggtatggtggatacaaaaagagatatgtttaggtttatagagagtgtaatattgcacctattta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43561490 |
gttgcagcaggcacggaaaaggagatatatgttcaaggtacggtggatacaaagagagatatgtttaggtttatagagagtgtaatattgcacctattta |
43561589 |
T |
 |
| Q |
116 |
tatatgcttatgttannnnnnnattgtaataaaataattattatggtccttgacc |
170 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43561590 |
tatatgcttatgttatttttttattgtaataaaataattattatggtccttgacc |
43561644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 247 - 357
Target Start/End: Original strand, 43561720 - 43561830
Alignment:
| Q |
247 |
tcaaggcaattattgttagcttttttgtccttactttttgtctttgaagcttttgcacacagaatttcataaactatcaattcgttcaaacttgatataa |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43561720 |
tcaaggcaattattgttagcttttttgtccttactttttgtctttgaagcttttgcacacagaatttcataaactatcaattcgttcaaacttgatataa |
43561819 |
T |
 |
| Q |
347 |
ttgttcttctc |
357 |
Q |
| |
|
||||| ||||| |
|
|
| T |
43561820 |
ttgtttttctc |
43561830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 297 - 351
Target Start/End: Complemental strand, 1600738 - 1600684
Alignment:
| Q |
297 |
ttttgcacacagaatttcataaactatcaattcgttcaaacttgatataattgtt |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||| || || |||||||||| |
|
|
| T |
1600738 |
ttttgcacacagaatttcataaactatcaatgcattcatacctggtataattgtt |
1600684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 287 - 351
Target Start/End: Complemental strand, 1621219 - 1621154
Alignment:
| Q |
287 |
tctttgaagctt-ttgcacacagaatttcataaactatcaattcgttcaaacttgatataattgtt |
351 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||| ||||| || ||||||| ||||| |
|
|
| T |
1621219 |
tctttgaaggttattgcacacagaatttcataaactatcaatgcgttcttacctgatatatttgtt |
1621154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 74 - 118
Target Start/End: Complemental strand, 29543217 - 29543173
Alignment:
| Q |
74 |
atatgtttaggtttatagagagtgtaatattgcacctatttatat |
118 |
Q |
| |
|
||||| |||||||||| |||||||||||| || |||||||||||| |
|
|
| T |
29543217 |
atatgattaggtttatggagagtgtaatactgaacctatttatat |
29543173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University