View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10124_low_14 (Length: 263)
Name: NF10124_low_14
Description: NF10124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10124_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 5 - 144
Target Start/End: Complemental strand, 10337118 - 10336980
Alignment:
| Q |
5 |
taaaaatttaaaattaagagatatcatcctgtatatatagaatctaaaaagtcattttttga-cgaagaaagtgatttatttggcatatgtgtatgaaag |
103 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10337118 |
taaaaattaaaaattaagagatatcatcctgtatata--gaatctaaaaagtcatttttttaacgaagaaagtgatttatttggcatatgtgtatgaaag |
10337021 |
T |
 |
| Q |
104 |
aaatttgattgagtggaaaattttcatatcgtatgttttat |
144 |
Q |
| |
|
||||||||||||||| ||||| ||||||| || |||||||| |
|
|
| T |
10337020 |
aaatttgattgagtgaaaaatattcatattgtgtgttttat |
10336980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 212 - 244
Target Start/End: Complemental strand, 10336913 - 10336881
Alignment:
| Q |
212 |
tctataattgtgaaaattttgtaacgataacac |
244 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
10336913 |
tctataattgtgaaaatgttgtaacgataacac |
10336881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University