View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10124_low_16 (Length: 247)
Name: NF10124_low_16
Description: NF10124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10124_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 16 - 164
Target Start/End: Complemental strand, 52511984 - 52511836
Alignment:
| Q |
16 |
gaggaaagcttgtctgccctgtttgtttaggaactggtgtgccaaacaataaaggtcttctcaggaggcctgacgcaaagaaactgcttgataagatgta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52511984 |
gaggaaagcttgtctgccctgtttgtttaggaactggtgtgccaaacaataaaggtcttctcaggaggcctgacgcaaagaaactgcttgataagatgta |
52511885 |
T |
 |
| Q |
116 |
taatggacgcctacttccaaattcttagaaggtatgtatactactcatg |
164 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52511884 |
taatggacgcctacttcccaattcttagaaggtatgtatactactcatg |
52511836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 174 - 234
Target Start/End: Complemental strand, 52511795 - 52511732
Alignment:
| Q |
174 |
atgttaatcttctgttgctgctgctg---ttatattcactgtactacatccttttcagtccttc |
234 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
52511795 |
atgttaatcttctgttgctgctgctgctgttatattcactgtactacatccttttcagtccttc |
52511732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University