View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10125_high_28 (Length: 264)
Name: NF10125_high_28
Description: NF10125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10125_high_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 25813938 - 25814184
Alignment:
| Q |
1 |
ctgagttgtggtttcaaaagaaactctacaaatgcagacatatgattcgtgaggctataaattctgatggatactgggtactaagaagatcgtggccaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25813938 |
ctgagttgtggtttcaaaagaaactctacaaatgcagacatatgattcgtgaggctattaattctgatggatactgagtactaagaagatcgtggccaaa |
25814037 |
T |
 |
| Q |
101 |
taatttggtatactcaaaggtatgtgttgatcaatttgaagcatgcaaagaaccacaactaaagaaaggtctttggtgggcgaattcagatgaggactac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25814038 |
taatttggtatactcaaaggtatgtgttgatcaatttgaagcatgcaaagaacaacaactaaagaaaggtctttggtgggcgaattcagatgaggactac |
25814137 |
T |
 |
| Q |
201 |
gaattcgacacttgcattaattgtcgtcttgacttggaagtggattg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25814138 |
gaattcgacacttgcattaattgtcgtcttgacttggaagtggattg |
25814184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University