View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10125_high_29 (Length: 257)
Name: NF10125_high_29
Description: NF10125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10125_high_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 46103937 - 46104181
Alignment:
| Q |
1 |
agtctcaaacgactcaccaaaccgtcccgattcttccagtcccattctaaacgattcgtttcaactccgagacgacttgctgtgaaagcttgcgcgatta |
100 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46103937 |
agtctcaaacgactcaccaaaccttctcgattcttccattcccattctaaacgattcgtttcaactccgagacgacttgctgtgaaagcttgcgcgatta |
46104036 |
T |
 |
| Q |
101 |
acgttgaagagaagaatgttgctgcaaaatcacaagaatgggggaaagtttctgcagtcttgtttgatatggacggtgttctctgtaacagtgaagaacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46104037 |
acgttgaagagaagaatgttgctgcaaaatcacaagaatgggggaaagtttctgcagtcttgtttgatatggacggtgttctctgtaacagtgaagaacc |
46104136 |
T |
 |
| Q |
201 |
ttctagaagagccggtgttgatttcttcgccgagatcggtgttca |
245 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46104137 |
ttctagaagatccggtgttgatttcttcgccgagatcggtgttca |
46104181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University