View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10125_high_43 (Length: 229)
Name: NF10125_high_43
Description: NF10125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10125_high_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 11 - 212
Target Start/End: Complemental strand, 41740520 - 41740319
Alignment:
| Q |
11 |
tgagaagaagaggatgaaacagtatttgagtcaggagagggagtataagaggaggatggagaaggcgaggccgtgtattttgccaaatacggttcatttg |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41740520 |
tgagaaggagaggatgaaacagtatttgagtcaggagagggagtataagaggaggatggagaaggcgaggccgtgtattttgccaaatacggttcatttg |
41740421 |
T |
 |
| Q |
111 |
gagattatggatatgatgaggaaagagaggagtttgagtgctaggttgttgcagaagattagggatagggttcagaagtggtatcatgatcaagggtatg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41740420 |
gagattatggatatgatgaggaaagagaggagtttgagtgctaggttgttgcagaagattagggatagggttcagaagtggtatcatgatcaagggtatg |
41740321 |
T |
 |
| Q |
211 |
ct |
212 |
Q |
| |
|
|| |
|
|
| T |
41740320 |
ct |
41740319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 24171246 - 24171181
Alignment:
| Q |
147 |
agtgctaggttgttgcagaagattagggatagggttcagaagtggtatcatgatcaagggtatgct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
24171246 |
agtgctaggttgttgcagaagattagggatagggttcagaaatggtatcatgatgaagggtatgct |
24171181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University