View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10125_low_14 (Length: 410)
Name: NF10125_low_14
Description: NF10125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10125_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 3 - 404
Target Start/End: Original strand, 48886145 - 48886538
Alignment:
Q |
3 |
gataatcccttacaggtctctgtttacggcgaacattcttatcctgtcaccgtcgcacgttactcccccaacggcgaatggatcgcgtccgctgatgttt |
102 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48886145 |
gataatcccttacaggtctctgtttacggcgaacattcttatcctgtcaccgtcgcacgttactcccccaacggcgaatggatcgcgtccgctgatgttt |
48886244 |
T |
 |
Q |
103 |
ccggtaccattcgcatttggggaactcataatgattatgttctcaagaacgaatttcgtgttctatctggtcggatcgatgatcttcagtggtctgcaga |
202 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48886245 |
ccggtaccattcgcatttggggaactcataatgattatgttctcaagaacgaatttcgtgttctatctggtcggatcgatgatcttcagtggtctgcaga |
48886344 |
T |
 |
Q |
203 |
ttgccagaggattgttgcttgtggagatggaaagggaaaatcgtttgtccgcgcttttatgtaatcatatttatccttttcatacctcattatttatgtt |
302 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48886345 |
ttgccagaggattgttgcttgtggagatggaaagggaaaatcgtttgtccgcgcttttatgtaatcatatttatccttttcatacctcattatttatgtt |
48886444 |
T |
 |
Q |
303 |
atgacttttgagttacaactgatcgaatgtgtgtcgagtgtttgtctaacatccaccacacgacactcactcatgtgattatattg-aactaattcttct |
401 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| | |
|
|
T |
48886445 |
atgacttttgagttacaactgatcgaat---------gtgtttgtctaacatccaccacacgacactcacttatgtgattatattgaaactaattctttt |
48886535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 197
Target Start/End: Complemental strand, 45099584 - 45099417
Alignment:
Q |
30 |
ggcgaacattcttatcctgtcaccgtcgcacgttactcccccaacggcgaatggatcgcgtccgctgatgtttccggtaccattcgcatttggggaactc |
129 |
Q |
|
|
||||||||| |||| |||| ||||||||| || | || |||||||| |||||| | || || ||||| || || |||||| | | || |||||||||| |
|
|
T |
45099584 |
ggcgaacatgcttaccctgccaccgtcgctcgattttcacccaacggtgaatgggttgcatctgctgacgtgtcaggtaccgtgaggatctggggaactc |
45099485 |
T |
 |
Q |
130 |
ataatgattatgttctcaagaacgaatttcgtgttctatctggtcggatcgatgatcttcagtggtct |
197 |
Q |
|
|
||||| | ||| | ||||| || ||||||||||| ||||| ||||||||||||||||||||||| |
|
|
T |
45099484 |
gcaatgaattcgttttgaagaaggagtttcgtgttctttctggaaggatcgatgatcttcagtggtct |
45099417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University